Controles Silenciamiento Génico -miRIDIAN microRNA Mimic Negative Control #2

Cod. Prov: CN-002000-01-05
Ref. Cultek: 77CN-002000-01-05
298,06 € sin iva
Para ver tus precios y comprar inicia sesión
Choose from two universal miRIDIAN Mimic Negative Controls for experiments with miRIDIAN microARN Mimics. Negative control sequences based on C. elegans microARNs have minimal sequence identity in human, mouse, and rat.
Más Información
Envase 5 nmol
Aplicaciones Silenciamiento génico
Categoría de Producto Controles miRNA
Subcategoría de Producto Negativo
Temperatura Envío Ambiente
Temperatura Almacenaje Refrigerado 4º
Disponibilidad Bajo pedido
Especificaciones Based on cel-miR-239b, mature sequence: UUGUACUACACAAAAGUACUG(MIMAT0000295) Cel-miR-239b confirmed to have minimal sequence identity with miarns in human, mouse, and rat Identical design and modifications as miRIDIAN microARN Mimics No identifiable effects on tested miarn function
Caracteristicas Differentiate between specific and non-specific effects with a negative control mimic Non-targeting mimics for use as controls in miarn mimic experiments Distinguish between specific mimic activity and background effects
